ISSN 0006-2979, Biochemistry (Moscow), 2023, Vol. 88, Nos. 12-13, pp. 1987-1996 © Pleiades Publishing, Ltd., 2023.
Published in Russian in Biokhimiya, 2023, Vol. 88, No. 12, pp. 2375-2386.
1987
A New Mouse Strain
with a Mutation in the NFE2L2 (NRF2) Gene
Evgeniy S. Egorov
1
, Natalia D. Kondratenko
2,3
, Olga A. Averina
2,4,5
,
Oleg A. Permyakov
4,5
, Maria A. Emelyanova
4,5
, Anastasia S. Prikhodko
1,2
,
Ludmila A. Zinovkina
1
, Petr V. Sergiev
2,4,5
, and Roman A. Zinovkin
2,6,a
*
1
Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University, 119991 Moscow, Russia
2
Belozersky Institute of Physico-Chemical Biology, Lomonosov Moscow State University, 119991 Moscow, Russia
3
Russian Clinical Research Center for Gerontology, Ministry of Health of the Russian Federation,
Pirogov Russian National Research Medical University, 129226 Moscow, Russia
4
Institute of Functional Genomics, Lomonosov Moscow State University, 119991 Moscow, Russia
5
Faculty of Chemistry, Lomonosov Moscow State University, 119991 Moscow, Russia
6
HSE University, 101000 Moscow, Russia
a
e-mail: roman.zinovkin@gmail.com
Received September 26, 2023
Revised November 22, 2023
Accepted November 23, 2023
Abstract— Transcription factor NRF2 is involved in inflammatory reactions, maintenance of redox balance, metabolism of
xenobiotics, and is of particular interest for studying aging. In the present work, the CRISPR/Cas9 genome editing tech-
nology was used to generate the NRF2
ΔNeh2
mice containing a substitution of eight amino acid residues at the N-terminus
of the NRF2 protein, upstream of the functional Neh2 domain, which ensures binding of NRF2 to its inhibitor KEAP1.
Heterozygote NRF2
wt/ΔNeh2
mice gave birth to homozygous mice with lower than expected frequency, accompanied by their
increased embryonic lethality and visual signs of anemia. Mouse embryonic fibroblasts(MEFs) from the NRF2
ΔNeh2/ΔNeh2
homozygotes showed impaired resistance to oxidative stress compared to the wild-type MEFs. The tissues of homo-
zygous NRF2
ΔNeh2/ΔNeh2
animals had a decreased expression of the NRF2 target genes: NAD(P)H:Quinone oxidoreduc-
tase-1(Nqo1); aldehyde oxidase-1 (Aox1); glutathione-S-transferaseA4 (Gsta4); while relative mRNA levels of the mono-
cyte chemoattractant protein1(Ccl2), vascular cell adhesion molecule1 (Vcam1), and chemokine Cxcl8 was increased.
Thus, the resulting mutation in the Nfe2l2 gene coding for NRF2, partially impaired function of this transcription factor,
expanding our insights into the functional role of the unstructured N-terminus of NRF2. The obtained NRF2
ΔNeh2
mouse
line can be used as a model object for studying various pathologies associated with oxidative stress and inflammation.
DOI: 10.1134/S0006297923120039
Keywords: transcription factor NRF2, transgenic animals, inflammation, oxidative stress
Abbreviations: AOX1,aldehyde oxidase-1; ARE,antioxidant response element; CCL2,monocyte attractant protein; GOx,glu-
cose oxidase; GSTA4,glutathione-S-transferase A4; HMOX1,hemoxygenase-1; KEAP1,Kelch-like ECH-associated protein1;
MEFs,mouse embryonic fibroblasts; Neh,Nrf2-ECH homology; NQO1,NAD(P)H: quinone oxidoreductase; NRF2,nuclear
factor2 related to erythroid factor2; ROS,reactive oxygen species; VCAM-1,vascular cell adhesion molecule1.
* To whom correspondence should be addressed.
INTRODUCTION
NRF2 (nuclear factor erythroid 2 related factor 2)
is a transcription factor that controls expression of many
genes products of which have antioxidant and anti-
inflammatory properties. In the cytoplasm, NRF2 is as-
sociated with the protein KEAP1 (Kelch-like ECH-as-
sociated protein 1), which under normal conditions pro-
motes permanent proteasomal degradation of NRF2[1].
Simultaneously, KEAP1 serves as a redox-sensitive
EGOROV et al.1988
BIOCHEMISTRY (Moscow) Vol. 88 Nos. 12-13 2023
regulator of NRF2 activity. When oxidizing agents and
electrophiles enter the cell, KEAP1 undergoes thiol
modification of its cysteine amino acid residues [2]. This
modification keeps KEAP1 bound to the NRF2. Due to
the lack of “vacant” negative regulators, the newly syn-
thesized NRF2 accumulates in the cytoplasm and then
moves to the nucleus. In the nucleus, NRF2 in complex
with its coactivators, including small proteins of the Maf
family, recognizes antioxidant response elements(ARE)
sequences in the promoters of its target genes and trig-
gers their transcription [3].
There are seven highly conserved Neh (NRF2-ECH
homology)-domains in the NRF2 structure [4, 5]. The
N-terminal part of the protein contains a Neh2 domain
(amino acids (aa) 16-86) that includes two sequences
known as DLG and ETGE motifs [6]. The NRF2 nega-
tive regulator KEAP1 binds to these sequences. KEAP1,
being an adaptor protein for the E3 ubiquitin ligase
complex Cullin 3 (Cul3), stimulates ubiquitinylation
of seven lysine residues located in the Neh2 domain of
NRF2 between the DLG and ETGE motifs and pro-
motes proteasomal degradation of the latter [6, 7].
The domains Neh1 (aa 435-562), Neh4 (aa 112-134),
Neh5 (aa 183-201), and Neh7 (aa 209-316) are respon-
sible for interaction of NRF2 with its coactivators and
corepressors [3, 8, 9]. The Neh6 domain (aa 338-388)
contains two degron sequences that are recognized by
the E3 ubiquitin-ligase β-TrCP [10, 11]. The C-terminal
part of the protein contains the Neh3 domain (aa 562-
605), which is responsible for recognizing ARE elements
in the promoters of the NRF2 target genes and contains
a VFLVPK motif that helps NRF2 to bind to the CHD6
helicase [12]. While NRF2 is complexly organized, this
protein is partially disordered and its Neh2, Neh7, and
Neh1 domains can only be structured for short periods
of time [13].
NRF2 activates transcription of the genes of the
2nd phase of xenobiotic detoxification responsible for
removal of the modified compounds from the cell.
NRF2 also actively participates in the cell defense
against electrophilic stress [14]. NRF2 also controls ex-
pression of the genes products of which are involved in
glutathione biosynthesis, as well as enzymes that directly
or indirectly neutralize reactive oxygen species (ROS):
NAD(P)H:quinone oxidoreductase (NQO1), hemoxy-
genase-1 (HO1), catalase (CAT). Reduction of ROS,
in turn, contributes to the cessation of inflammatory
responses. When the Nfe2l2 expression is decreased, in-
flammation increases, which can lead to organ and tis-
sue damage [15]. Downregulation of the Nfe2l2 expres-
sion in monocytes results in the increased production of
pro-inflammatory cytokines [16]. Mouse models have
shown increase in the ROS levels leading to prolonged
oxidative stress after brain injury [17].
Gene knockouts are widely used to study functions
of transcription factors. The Nfe2l2 knockout mice lack-
ing the NRF2 transcription factor were obtained more
than a quarter of a century ago [18], and all subsequent
experiments have been performed exclusively with this
line. In these mice, a cistron from the lactose operon
was inserted into the Nfe2l2 gene, resulting in inability
to synthesize functional mRNA and protein product.
However, the use of knockout animals often results in
the secondary effects that make it difficult to interpret
the obtained results. It is likely that in the case of com-
plete absence of any transcription factor, secondary
effects may be due to the absence of its associated co-
factors. It is important to create new models with muta-
tions in the domains of transcription factors, rather than
compromising integrity of the protein structure. Another
problem with the gene deletion approach is possible re-
moval of one or more noncoding RNAs found in the in-
trons and exons.
In this work, a new mutant mouse line, NRF2
ΔNeh2
,
carrying an 8-aa substitution at the N-terminus of NRF2,
was obtained; embryonic fibroblasts(MEFs) were char-
acterized, and changes in the mRNA levels of a num-
ber of NRF2 target genes in various tissues of these ani-
mals were determined. This mouse line can be used as a
model object for studying embryonic mortality, various
pathologies accompanied with oxidative stress and in-
flammation, as well as for studying aging processes.
MATERIALS AND METHODS
Animals and work with them. Animals were kept in in-
dividually ventilated cages (IVC system, TECNIPLAST
S.p.A., Italy) with free access to food and water purified
by reverse osmosis, in an environment free of specific
pathogens, with light regime 12/12 (light on at 09:00),
in rooms with air exchange rate more than 15 r/h, at
20-24°C, humidity 30-70%. Wood chips with minimal
dust formation were used as bedding. Shelters and build-
ing materials for nests made of natural materials were
used as enrichment of the environment. All materials
supplied to the animals were sterilized by autoclaving.
Transgenic animal generation. The work with an-
imals was approved by the local bioethics committee
“Institute of Mitoengineering MSU” LLC, protocol #79
of April 28, 2015. Mutation in the Nfe2l2 gene was in-
troduced using CRISPR/Cas9 technology. The guide
RNA (5′-GACTTGGAGAGTTGCCACCGCC) to the
first exon of this gene was selected using the Feng Zhang
laboratory (http://crispr.mit.edu/) service. The corre-
sponding single-guide RNA (sgRNA) was produced by
in vitro transcription of T7 (MEGAscript™ T7 Tran-
scription Kit, Thermo Fisher, USA) on a matrix ob-
tained by PCR amplification of a plasmid pX458 [19]
with forward primer: 5′-TGTAATACGACGACTCAC
TATATAGGGACTTGGAGTTGAGTTGCCACCGC
CGTTTTTTTAGAGAGCTAGAAATAGC and reverse
MOUSE WITH MUTATION IN THE NRF2 GENE 1989
BIOCHEMISTRY (Moscow) Vol. 88 Nos. 12-13 2023
primer: 5′-AGCACCACCGACACTCGGTGCCACT.
The sgRNA was mixed with Cas9 mRNA (GeneArt™
CRISPR Nuclease, ThermoFisher) in a TE buffer
(10mM Tris-HCl, 0.1mM EDTA, pH8).
Single-cell embryos for subsequent microinjection
of the genetic construct were isolated from oviducts
of female mice according to a standard protocol [20].
Female zygote donors were preliminarily hormonally
stimulated according to the scheme described by Averi-
na etal.[21] and fertilized by males of the corresponding
lineage [21].
Microinjection of the genetic construct into the
pronucleus of a fertilized oocyte was performed in
an oocyte washing medium with phenol red, pH 7.4,
without heparin (CooperSurgical, Inc., USA, USA),
surrounded by vaseline oil (JSC Tatkhimfarmprepa-
raty, Kazan, Russia) on an inverted microscope
(ECLIPSE Ti, Nikon, Japan) using two micromanipu-
lators (TransferMan 4R, Eppendorf, Germany), accord-
ing to the previously described protocol [20]. Zygotes
after microinjection were incubated in an atmosphere
of 5% CO
2
at 37°C in a Sequential Fert™ medium with
phenol red (CooperSurgical, Inc.). After incubation,
surviving embryos were implanted in oviduct funnel
of surrogate females according to the standard proto-
col[20]. After birth and completion of lactation period,
mice were genotyped using tip of the tail, according to
the FELASA guidelines for genotyping transgenic ro-
dents [22]. Tissue samples for genotype identification
were frozen at –20°C until genotyping.
The resulting heterozygous mice (Nrf2
wt/ΔNeh2
) were
crossed to the inbred line C57BL/6J to avoid poten-
tial effects of secondary mutations. Homozygous indi-
viduals of Nrf2
ΔNeh2/ΔNeh2
and wild-type Nrf2
WT/WT
mice
were obtained from crosses between heterozygous pairs
of Nrf2
wt/ΔNeh2
.
Mice genotyping. Alkaline extraction method was
used to isolate genomic DNA from tissue samples [23]
followed by purification of DNA by phenol-chloro-
form extraction. An Encyclo Plus PCR kit (Evrogen,
Russia) with 50 ng of genomic DNA was used for ge-
notyping. PCR1 with primers mNrf-F476 (5′-GCAG
GCTATCTCTCCTAGTTCT) and mNrf-R668 (5′-CG
GCTTCTTGGCACAG) and PCR2 with primers
mNrf-F476 and mNrf-R1153 (5′-GACAGGCGTGATC
TTACAG) were performed on the DNA template. PCR
regime: 95°C for 5 min, followed by 35 cycles (95°C for
25 s, 60°C for 25 s, 72°C for 25 s). PCR products were
analyzed electrophoretically in a 1.5% agarose gel.
Mouse embryonic fibroblasts (MEF). Embryos were
isolated at 10-14
th
day post coitus from heterozygous
pregnant females (Nrf2
wt/ΔNeh2
) crossed with a male het-
erozygote. MEF isolation was performed according to
the method described in [24]. The cells were cultured on
a Dulbecco’s modified Eagle medium (DMEM) (Pan-
Eco, Russia).
RNA isolation, reverse transcription, and real-time
PCR. Total cellular RNA was isolated using a QuickRNA
MiniPrep reagent kit (ZymoResearch, USA) accord-
ing to the manufacturer’s protocol. RNA concentration
was determined using a Nanodrop ND-1000 spectro-
photometer (Thermo Scientific, USA), RNA quality
was confirmed electrophoretically. Reverse transcrip-
tion was performed using a SuperScript III kit (Ther-
moFischer, USA) as described previously[25] for sub-
sequent analysis by real-time PCR with an EvaGreenI
intercalating dye (Syntol, Russia). The following
primers were used for real-time PCR: Hmox1 (for-
ward: 5′-CACGCATATATATACCCGCTACC; reverse:
5′-TCATCTCCAGAGAGTGTTCATTCG); Nqo1 (for-
ward: 5′-GTCCTCCATCAAGATTCG; reverse: 5′-GC
TAACTGCTAACTGCTAACTGCTAA); Aox1 (forward:
5′-CATAGGTCAGGTTGAAGGTGAAGGT; reverse:
5′-GGCAGGAATCTTGTATTGG); Gsta4 (forward:
5′-AGCAACATTCCTACAATTAAGAAGT; reverse: 5′-TC
CTGACCACCACCTCAACATAG); Vcam1 (forward:
5′-CCCTCCACACAAACCAAGCC; reverse: 5′-CCATTC
CAGTCACTTCAACG); Il-6 (forward: 5′-ACCGCTA
TGAAGTTCCTCTCTCTC; reverse: 5′-CTCTGTGAA
GTCTCCTCCTCTCC); Cxcl8 (forward: 5′-ACTTCAA
GAACATCCAGAGC; reverse: 5′-CTTTCCAGGTCA
GTTAGTTAGCC). Nucleotide sequences of primers for
Ccl2 and reference genes Rpl32 and Gapdh are given in
Ref.[26].
Western blot. MEFs were lysed in a hot SDS buf-
fer (62.5 mM Tris-HCl, pH 6.8; 2% SDS; 10% glycerol;
50 mM DTT, 0.01% bromophenol blue) for 5 min at
94°C. Proteins were separated by electrophoresis using
12% SDS-PAGE, transferred to a PVDF membrane (Bio-
Rad, USA), and sequentially incubated with rabbit anti-
bodies against NRF2 (Invitrogen, USA) and horseradish
peroxidase-labeled goat anti-rabbit immunoglobulin sec-
ondary antibodies (Sigma Aldrich, USA). AWest Dura
Extended Duration Substrate (Thermo Fisher) was used
as a substrate for peroxidase, and images were acquired
using a ChemiDoc gel documentation system (Bio-Rad).
Cytotoxic test. Resazurin test was performed ac-
cording to the standard protocol as described previ-
ously[25]. Experiments to study the effect of oxidative
stress on survival of MEFs were performed when cells
were exposed to 250 μM H
2
O
2
(Ecotex, Russia) and
3 units/ml glucose oxidase (GOx) (Sigma-Aldrich®,
USA) for 3h, n=3.
DNA sequencing. DNA sequencing was performed
using an ABI PRISM® BigDye™ Terminator reagent
kit v.3.1 followed by analysis of reaction products on an
Applied Biosystems3730 DNA Analyzer.
Statistical analysis. The results of crosses between
mice were analyzed using the χ
2
criterion. Differences in
the levels of gene expression between groups, as well as
in survival of MEFs, was determined using the unpaired
Student’s t-test.
EGOROV et al.1990
BIOCHEMISTRY (Moscow) Vol. 88 Nos. 12-13 2023
RESULTS
Transgenic mice with a mutation in the Nrf2 gene.
Using CRISPR/Cas9 technology and guide RNA cor-
responding to the first exon of the Nfe2l2 gene, a female
F0 mouse was made with a 284nt deletion affecting the
boundary of the first exon and intron of the Nfe2l2 gene
(Fig.1). To eliminate the influence of possible second-
ary mutations caused by the nonspecific effect of ge-
nomic editing, sequential crosses of heterozygotes with
inbred mice of the C57BL/6J line were performed for
ten generations. Heterozygote crosses then produced
homozygous animals, as well as wild-type and heterozy-
gous animals of different sexes.
The observed deletion in the region affecting the
splicing site (5′-CAG|GTGCTGCCC) between the first
exon and intron of the Nfe2l2 gene could, theoretical-
ly, prevent splicing of the Nfe2l2 pre-mRNA and lead to
the subsequent degradation of this transcript. Thus, one
would expect to obtain an animal knockout of Nfe2l2.
However, cDNA sequencing of the Nfe2l2 gene re-
vealed deletion of the codon encoding 8aa residues at
the 3′-end region of the first exon (PPGLQSQQQ),
which were replaced by two aa residues (RW) formed
during translation of the non-coding region of the first
intron (Fig. 1b). At the same time, rest of the NRF2
cDNA remained unchanged. Based on these data, we
concluded that alternative splicing occurs in the ob-
tained NRF2
ΔNeh2
mouse line due to activity of the hid-
den donor splice site (5′-TGG|GTGGGGGAGGC) in
the first intron of the Nfe2l2 gene. Although we had
not obtained the Nfe2l2 knockout mouse, work on this
unique mouse model with a mutation in this gene was
continued.
NRF2
ΔNeh2/ΔNeh2
homozygous mice have increased
embryonic lethality. A total of 22 wild-type (37%),
34heterozygotes (57%), and 3 homozygotes (5%) were
obtained from the crosses between heterozygous mice.
Fig. 1. Structure of Nfe2l2 gene in wild-type and in the NRF2
ΔNeh2
mice. a)WT pre-mRNA sequence of Nfe2l2 gene; b)pre-mRNA sequence
ofthe Nfe2l2 gene with deletion obtained using CRISPR/Cas9 and guide RNA (gRNA). The deleted region of the gene is marked in gray, and
alternative splicing site in the first intron of the gene is also depicted; c)sequence of the mature spliced mRNA of the Nfe2l2 gene with the in-
troduced mutation (substitutions are marked in black); d)domains of the NRF2 protein and comparison of the aa sequences between NRF2
ΔNeh2
andWT. The mutation is located at the N-terminus of NRF2 and represents deletion of 8aa (PPGLQSQQQ) substituted by two aa (RW) that were
translated from the non-coding region of the first intron. The mutation affects positions 8-15, which are adjacent to the Neh2 domain responsible
for binding of NRF2 to its negative regulator KEAP1.
MOUSE WITH MUTATION IN THE NRF2 GENE 1991
BIOCHEMISTRY (Moscow) Vol. 88 Nos. 12-13 2023
Fig. 2. Representative photographs of embryos from the wild-type(WT) and homozygous mice with mutation in the Nfe2l2 gene (NRF2
ΔNeh2
).
Embryos obtained by crossing heterozygotes at days 9, 10-12, and 17-21 were analyzed, and NRF2
ΔNeh2
homozygotes show signs of anemia.
The number of genotypes obtained was not consis-
tent with the Mendelian type of inheritance (p=0.001
byχ
2
test), leading to assumption of increased embryon-
ic lethality of homozygotes. Indeed, analysis of embry-
os obtained on days 9, 11, and 17-21 after conception
showed signs of anemia and death in some homozygous
embryos (Fig.2). A total of 55 embryos were analyzed,
of which 12 were wild-type (22%), 29 heterozygotes
(53%), and 14 homozygotes (25%) (p=0.81 by χ
2
test).
MEFs from homozygous NRF2
ΔNeh2/ΔNeh2
mice have
reduced resistance to oxidative stress. Oxidative stress
in MEFs was induced by addition of 250μM H
2
O
2
or
3 units/ml glucose oxidase (GOx) for 3 h. When H
2
O
2
was used to induce oxidative stress, MEFs from the ho-
mozygous mutant mice had slightly lower survival rates
compared to the cells from the wild-type mice (Fig.3).
Additionally, when GOx was added, survival rate of the
MEFs from the wild-type mice was 50% and surviv-
al rate of the MEFs from homozygous mutant mice
was30%. This suggests that the MEFs from the animals
with mutation in the Nrf2 gene are less resistant to oxi-
dative stress caused by addition of GOx compared to the
wild-type cells.
MEFs of homozygous NRF2
ΔNeh2/ΔNeh2
mice have re-
duced expression levels of the Nfe2l2 mRNA and its target
genes. Homozygous MEFs with mutation in the Nfe2l2
gene exhibited decrease in the expression of Nfe2l2
mRNA and its target genes, as well as increase in the
mRNA levels of the inflammation marker Ccl2 (Fig.4a).
Interestingly, when analyzing the same sample of MEFs,
the amount of Nfe2l2 mRNA in the NRF2
ΔNeh2
mice
was approximately 10 times lower than in the WT mice,
while the amount of NRF2 protein showed almost no
difference (Fig.4,b andc).
Tissues of NRF2
ΔNeh2/ΔNeh2
homozygous mice have
reduced levels of the Nfe2l2 mRNA and some of its tar-
get genes, while expression of the inflammatory markers
Fig. 3. MEFs from the homozygous mutant animals (NRF2
ΔNeh2
) have
greater sensitivity to the GOx-induced oxidative stress than the MEFs
from the wild-type (WT) animals. Cell death was induced by hydrogen
peroxide (250μM H
2
O
2
) or glucose oxidase (3u/ml GOx). Fibroblast
viability was measured by resazurin test. The data are presented as a
mean +/–SEM, n=3, *p<0.05, when compared to WT by unpaired
Student’s t-test.
EGOROV et al.1992
BIOCHEMISTRY (Moscow) Vol. 88 Nos. 12-13 2023
Fig. 4. Expression levels of Nfe2l2, its target genes, and inflammatory marker genes in the MEFs of NRF2 homozygotes
ΔNeh2/ΔNeh2
(NRF2
ΔNeh2
)
and wild-type
NRF2wt/wt
(WT) mice: a) real-time PCR data of relative mRNA levels in the MEFs of WT and homozygous NRF2
ΔNeh2
mice.
Hmox1, heme oxygenase-1, NRF2 target; Nqo1, NAD(P)H:quinone oxidoreductase-1, NRF2 target; Aox1, aldehyde oxidase-1, NRF2 tar-
get; Gsta4,glutathione-S-transferaseA4, NRF2 target; Ccl2,monocyte chemoattractant protein1; Vcam1,vascular cell adhesion molecule 1.
ThemRNA level for WT was taken as 100%. The data are presented as a mean +/–SEM, n=4. b)Relative amount of Nfe2l2 mRNA in the MEFs
of a mouse#1 (WT) and mouse#2 (NRF2
ΔNeh2
). c)Western blot of the NRF2 protein in the MEFs of mouse#1 (WT) and mouse#2 (NRF2
ΔNeh2
).
Fig. 5. Expression levels of NRF2, its target genes, and inflammatory marker genes in the tissues of wild-type (WT) animals and animals homozy-
gous for the mutation in Nfe2l2 (NRF2
ΔNeh2
). Real-time PCR results showing relative amounts of mRNA in: a)liver, b)brain, c)heart, d)kidney,
and e)tibialis anterior muscle of the NRF2
ΔNeh2
and WT mice. Hmox1,hemoxygenase-1, target of NRF2; Nqo1,NAD(P)H:quinone oxidoreduc-
tase-1, NRF2 target; Aox1,aldehyde oxidase-1, NRF2 target; Gsta4,glutathione-S-transferase A4, NRF2 target; Ccl2,monocyte chemoattractant
protein1; Vcam1,vascular cell adhesion molecule1; Il-6,interleukin6; Cxcl8,interleukin8, chemokine. The mRNA level for WT was taken
as100%. The data are presented as a mean +/–SEM, n=3. *p<0.05 when compared to the WT by unpaired Student’s t-test.
Ccl2, Vcam1, and Cxcl8 is upregulated. A twofold de-
crease in the expression of the Nfe2l2 mRNA and its
target Nqo1, and slight decrease in the expression of two
other NRF2 targets, Aox1 and Gsta4, were observed in
the livers of homozygous mutant mice (Fig.5a). There
was also a twofold increase in the amount of the Ccl2
gene mRNA, one of the markers of inflammation, in
the liver of mutant animals. In the brains of homozy-
gous mutant animals, the expression of Nfe2l2 and
its target gene Aox1 decreased twofold; the amount of
mRNA of other genes was almost unchanged (Fig.5b).
In the heart of homozygous mice, we observed a signif-
MOUSE WITH MUTATION IN THE NRF2 GENE 1993
BIOCHEMISTRY (Moscow) Vol. 88 Nos. 12-13 2023
icant decrease in the amount of Nfe2l2 mRNA and its
target gene Aox1 and slight decrease in the expression
level of Nqo1 (Fig.5c). Also, in the heart of NRF2
ΔNeh2
animals, there was a slight increase in the mRNA level
of Ccl2. In the kidneys of the NRF2
ΔNeh2
mice, there was
a significant decrease in the expression level of Nfe2l2,
Nqo1, and Aox1 and increase in the mRNA amounts of
the inflammation marker genes Ccl2, Vcam1, and Cxcl8
(Fig.5d). In the tibialis anterior muscle of the homozy-
gous mice, there was decrease in the amount of Nfe2l2,
Nqo1, and Aox1 mRNAs, slight decrease in the Gsta4
expression, and increase in the amount of mRNA for
the inflammation marker Ccl2 (Fig. 5d). Surprisingly,
there was no significant change in the expression level
of Hmox1 in any of the tissues examined. Measurement
of the relative mRNA level of the chemokine Cxcl8 in
the tibial muscle, as well as of the mRNA of the cyto-
kines Tnf and IL-1β in all tissues was not possible due
to the high values of threshold cycles (Ct > 35 cycles) in
real-time PCR.
Thus, in the tissues of the NRF2
ΔNeh2
homozygous
mice expression levels of both Nfe2l2 itself and some of
its targets decreased, and at the same time the expres-
sion level of some inflammatory markers increased.
DISCUSSION
We have created the mice with mutation in the
gene encoding the NRF2 transcription factor (Fig.1).
Themutation involves 8 amino acid residues located in
the first exon of the N-terminal part of the NRF2 se-
quence at positions 8-15 (PPGLQSQQQ), which are re-
placed by two aa (RW). The N-terminal part of NRF2
contains the Neh2 domain responsible for binding of
NRF2 to its negative regulator KEAP1, but amino acid
residues located at positions 1-15 are usually not includ-
ed in the Neh2 domain because they are not conserved
among the NRF2 homologous proteins [27, 28]. How-
ever, in the work of MacMahon etal. [11] it was shown
that deletion of amino acid residues 1-16 leads to the
slight increase in the half-life of NRF2, and this effect is
not associated with the impaired protein ubiquitination.
In this study, it was shown that despite the fact that the
introduced mutation affects a non-conserved region of
the NRF2 amino acid sequence, it, nevertheless, affects
protein function, which is manifested in the mutant an-
imals as increased embryonic mortality, decreased MEF
survival, reduced amounts of Nfe2l2 mRNA and some of
its targets, and increased expression of the inflammatory
markers in the MEFs and some organs of the NRF2
ΔNeh2
homozygotes.
It is known that the decreased NRF2 levels lead
to the decreased cell and tissue resistance to oxida-
tive stress. Thus, hyperoxia caused more pronounced
lung damage in the Nfe2l2 knockout mice compared
to the WT [29]. In these same animals, exposure to
cigarette smoke and diesel exhaust caused increase in
the 8-oxo-7,8-dihydro-2′-deoxyguanosine levels, indi-
cating oxidative DNA damage [30, 31]. In addition, the
increased oxidative damage has been observed in the
knockout mice upon exposure to allergens that lead to
airway inflammation [32], a similar effect has been ob-
served in sepsis [33]. It was previously shown that MEFs
from the Nfe2l2 knockout mice have an increased sensitiv-
ity to oxidative stress induced by diquat dibromide[34],
as well as organic and inorganic peroxides [35]. Con-
sistent with the above observations, we also observed
decreased survival of the Nfe2l2 mutant MEFs in our
work (Fig.3).
An unexpected result of our work was observation
that mutation in the N-terminal region of NRF2 leads
to increased embryonic lethality (Fig.2). Part of the ho-
mozygous embryos had signs of anemia, which may be
a consequence of the impaired erythrocyte production,
erythropoiesis. It is interesting to note that the study of
transcription factor NRF2 began due to the discovery of
its role in erythropoiesis, which is reflected in its name
[nuclear factor (erythroid-derived2)-like2]: NRF2 was
discovered as a protein that recognizes the promoter re-
gion of the beta-globin gene [36]. However, no eryth-
ropoiesis-related abnormalities were observed in the
generated NRF2 knockout mice, nor did they exhibit
anemia, embryonic lethality, or reduced fertility [17].
It is conceivable that the NRF2 mutation could affect
erythropoiesis in the homozygous mice in other ways:
for example, by disrupting the ability of NRF2 to regu-
late expression of the genes responsible for heme biosyn-
thesis, a key component of hemoglobin (see Ref.[37]).
Nevertheless, the exact causes and mechanisms of em-
bryonic death remain unknown.
The MEFs of NRF2
ΔNeh2
homozygous mice showed
decreased mRNA levels of Nfe2l2, as well as decreased
mRNA levels of most of its targets (Fig.4a). This de-
crease was also observed in the tissues of homozygous
animals (Fig. 5) suggesting that the NRF2 transcrip-
tional activity is impaired in these mice. Similar changes
in the gene expression profile have been previously de-
scribed in various tissues of the Nfe2l2 knockout mice
[38-41]. Interestingly, although the Nfe2l2 mRNA levels
were downregulated in the MEFs of the NRF2
ΔNeh2
ho-
mozygotes compared to the WT, the amount of protein
on Western blot was almost indistinguishable (Fig.4,b,
andc). This could probably be a consequence of the in-
creased lifetime of the NRF2
ΔNeh2
protein, as described
by MacMahon et al. [11], however, this assumption re-
quires further verification.
NRF2 controls the expression of genes that regulate
inflammatory response, and its activation in various invitro
and in vivo models generally reduces inflammation, in-
cluding downregulation of the chemokine Ccl2 and
the vascular cellular adhesion molecule Vcam1 [42-44].
EGOROV et al.1994
BIOCHEMISTRY (Moscow) Vol. 88 Nos. 12-13 2023
The NRF2
ΔNeh2
mice showed increased expression of
these genes in most tissues, indicating that this mouse
line can be used as a model for excessive inflammatory
activation, particularly in renal tissues where the greatest
changes in gene expression were observed (Fig.5d).
NRF2 also controls genes that regulate antiox-
idant response of the cells including diaphorase Nqo1
and genes encoding important glutathione biosynthe-
sis enzymes, such as glutathione transferases and glu-
tamate-cysteine ligases. The levels of Nqo1 and Gsta4
mRNAs were found to be decreased in various tissues
of the NRF2
ΔNeh2
mice (Fig.5), which suggests potential
impairment of the redox balance and possible develop-
ment of oxidative stress in these animals. However, this
issue was not investigated in this study.
Thus, in our work, we obtained a new mutant mouse
line with substitution of 8aa at the N-terminal region
of NRF2, which resulted in partial disruption of the
functions of this transcription factor and increased em-
bryonic mortality. The obtained mouse line can be used
as amodel object to study various developmental pathol-
ogies associated with the impaired NRF2 functions.
Acknowledgments. The authors would like to thank
Olga Yurievna Pletjushkina for her invaluable help in
working with the MEFs.
Contributions. E.S.E. conducting experiments, writ-
ing the text, N.D.K. conducting experiments, statistical
analysis, and preparation of figures (E.S.E. and N.D.K.
contributed equally to the work), O.A.A. working with
laboratory animals, conducting experiments, discuss-
ing the results of the study, O.A.P., M.A.E., and A.S.P.
conducting experiments, L.A.Z. and P.V.S. conducting
experiments, discussing the results of the study, R.A.Z.
writing the text, concept and guiding the work.
Funding. This work was financially supported by the
Russian Science Foundation (project no.21-64-00006).
Ethics declarations. The work with mice was approved
by the local bioethics committee “Institute of Mitoengi-
neering MSU” LLC, protocol #79 of April 28, 2015.
Conflict of interest. The authors of this work de-
clare that they have no conflicts of interest.
REFERENCES
1. Kobayashi, A., Kang, M.-I., Okawa, H., Ohtsuji, M.,
Zenke, Y., Chiba, T., etal. (2004) Oxidative stress sensor
Keap1 functions as an adaptor for Cul3-based E3 ligase to
regulate proteasomal degradation of Nrf2, Mol. Cell. Biol.,
24, 7130-7139, doi:10.1128/MCB.24.16.7130-7139.2004.
2. Kobayashi, A., Kang, M.-I., Watai, Y., Tong, K.I., Shi-
bata, T., Uchida, K., etal. (2006) Oxidative and electro-
philic stresses activate Nrf2 through inhibition of ubiq-
uitination activity of Keap1, Mol. Cell. Biol., 26, 221-229,
doi:10.1128/MCB.26.1.221-229.2006.
3. Motohashi, H., Katsuoka, F., Engel, J.D., and Yamamo-
to, M. (2004) Small Maf proteins serve as transcriptional
cofactors for keratinocyte differentiation in the Keap1-
Nrf2 regulatory pathway, Proc. Natl. Acad. Sci. USA, 101,
6379-6384, doi:10.1073/pnas.0305902101.
4. Tonelli, C., Chio, I. I. C., and Tuveson, D. A. (2018)
Transcriptional regulation by Nrf2, Antioxid. Redox Sig-
nal., 29, 1727-1745, doi:10.1089/ars.2017.7342.
5. Saha, S., Buttari, B., Panieri, E., Profumo, E., and
Saso,L. (2020) An overview of Nrf2 signaling pathway and
its role in inflammation, Molecules, 25, 5474, doi:10.3390/
molecules25225474.
6. Tong, K. I., Katoh, Y., Kusunoki, H., Itoh, K., Tanaka, T.,
and Yamamoto, M. (2006) Keap1 recruits Neh2 through
binding to ETGE and DLG motifs: characterization of
the two-site molecular recognition model, Mol. Cell. Biol.,
26, 2887-2900, doi:10.1128/MCB.26.8.2887-2900.2006.
7. Zhang, D. D., Lo, S.-C., Cross, J. V., Templeton, D.J.,
and Hannink, M. (2004) Keap1 is a redox-regulated
substrate adaptor protein for a Cul3-dependent ubiq-
uitin ligase complex, Mol. Cell Biol., 24, 10941-10953,
doi:10.1128/MCB.24.24.10941-10953.2004.
8. Katoh, Y., Itoh, K., Yoshida, E., Miyagishi, M., Fukam-
izu, A., and Yamamoto, M. (2001) Two domains of Nrf2
cooperatively bind CBP, a CREB binding protein, and
synergistically activate transcription Internet, Genes Cells,
6, 857-868, doi:10.1046/j.1365-2443.2001.00469.x.
9. Wang, H., Liu, K., Geng, M., Gao, P., Wu, X., Hai, Y.,
et al. (2013) RXRα inhibits the NRF2-ARE signaling
pathway through a direct interaction with the Neh7 do-
main of NRF2, Cancer Res., 73, 3097-3108, doi:10.1158/
0008-5472.CAN-12-3386.
10. Rada, P., Rojo, A. I., Chowdhry, S., McMahon, M.,
Hayes, J.D., and Cuadrado, A. (2011) SCF/β-TrCP pro-
motes glycogen synthase kinase 3-dependent degradation
of the Nrf2 transcription factor in a Keap1-independent
manner, Mol. Cell. Biol., 31, 1121-1133, doi: 10.1128/
MCB.01204-10.
11. McMahon, M., Thomas, N., Itoh, K., Yamamoto, M.,
and Hayes, J.D. (2004) Redox-regulated turnover of Nrf2
is determined by at least two separate protein domains,
the redox-sensitive Neh2 degron and the redox-insen-
sitive Neh6 degron, J. Biol. Chem., 279, 31556-31567,
doi:10.1074/jbc.M403061200.
12. Nioi, P., Nguyen, T., Sherratt, P. J., and Pickett, C.B.
(2005) The carboxy-terminal Neh3 domain of Nrf2
is required for transcriptional activation, Mol. Cell.
Biol., 25, 10895-10906, doi: 10.1128/MCB.25.24.
10895-10906.2005.
13. Karunatilleke, N. C., Fast, C. S., Ngo, V., Brickend-
en, A., Duennwald, M.L., Konermann, L., etal. (2021)
Nrf2, the major regulator of the cellular oxidative stress re-
sponse, is partially disordered, Int.J. Mol. Sci., 22, 7434,
doi:10.3390/ijms22147434.
14. Kansanen, E., Jyrkkänen, H.-K., and Levonen, A.-L.
(2012) Activation of stress signaling pathways by elec-
MOUSE WITH MUTATION IN THE NRF2 GENE 1995
BIOCHEMISTRY (Moscow) Vol. 88 Nos. 12-13 2023
trophilic oxidized and nitrated lipids, Free Radic.
Biol. Med., 52, 973-982, doi: 10.1016/j.freeradbiomed.
2011.11.038.
15. Reddy, N. M., Potteti, H. R., Mariani, T. J., Biswal, S.,
and Reddy, S. P. (2011) Conditional deletion of Nrf2
in airway epithelium exacerbates acute lung injury and
impairs the resolution of inflammation, Am. J. Re-
spir. Cell Mol. Biol., 45, 1161-1168, doi: 10.1165/rcmb.
2011-0144OC.
16. Rushworth, S. A., Shah, S., and MacEwan, D.J. (2011)
TNF mediates the sustained activation of Nrf2 in human
monocytes, J. Immunol., 187, 702-707, doi: 10.4049/
jimmunol.1004117.
17. Lu, X.-Y., Wang, H.-D., Xu, J.-G., Ding, K., and Li, T.
(2015) Deletion of Nrf2 exacerbates oxidative stress after
traumatic brain injury in mice, Cell. Mol. Neurobiol., 35,
713-721, doi:10.1007/s10571-015-0167-9.
18. Chan, K., Lu, R., Chang, J. C., and Kan, Y. W. (1996)
NRF2, a member of the NFE2 family of transcription
factors, is not essential for murine erythropoiesis, growth,
and development, Proc. Natl. Acad. Sci. USA, 93, 13943-
13948, doi:10.1073/pnas.93.24.13943.
19. Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott,
D. A., and Zhang, F. (2013) Genome engineering using
the CRISPR-Cas9 system, Nat. Protoc., 8, 2281-2308,
doi:10.1038/nprot.2013.143.
20. Cho, A., Haruyama, N., and Kulkarni, A. B. (2009)
Generation of transgenic mice, Curr. Protoc. Cell Biol.,
42, 19.11.1-19.11.22, doi:10.1002/0471143030.cb1911s42.
21. Averina, O. A., Vysokikh, M. Y., Permyakov, O. A., and
Sergiev, P. V. (2020) Simple recommendations for im-
proving efficiency in generating genome-edited mice, Acta
Naturae, 12, 42-50, doi:10.32607/actanaturae.10937.
22. Bonaparte, D., Cinelli, P., Douni, E., Hérault, Y.,
Maas, M., Pakarinen, P., et al. (2013) FELASA guide-
lines for the refinement of methods for genotyping ge-
netically-modified rodents: a report of the Federation
of European Laboratory Animal Science Associations
Working Group, Lab. Anim., 47, 134-145, doi: 10.1177/
0023677212473918.
23. Truett, G. E., Heeger, P., Mynatt, R. L., Truett, A. A.,
Walker, J.A., and Warman, M.L. (2000) Preparation of
PCR-quality mouse genomic DNA with hot sodium hy-
droxide and tris (HotSHOT), Biotechniques, 29, 52-54,
doi:10.2144/00291bm09.
24. Qiu, L.-Q., Lai, W. S., Stumpo, D. J., and Blackshear,
P. J. (2016) Mouse embryonic fibroblast cell culture
and stimulation, Bio Protoc., 6, e1859, doi: 10.21769/
BioProtoc.1859.
25. Zinovkina, L. A., Galivondzhyan, M. K., Prikhodko,
A.S., Galkin, I.I., and Zinovkin, R.A. (2020) Mitochon-
dria-targeted triphenylphosphonium-based compounds
do not affect estrogen receptor alpha, PeerJ, 8, e8803,
doi:10.7717/peerj.8803.
26. Zinovkin, R. A., Romaschenko, V. P., Galkin, I. I.,
Zakharova, V. V., Pletjushkina, O. Y., Chernyak, B. V.,
etal. (2014) Role of mitochondrial reactive oxygen species
in age-related inflammatory activation of endothelium,
Aging, 6, 661-674, doi:10.18632/aging.100685.
27. Itoh, K., Wakabayashi, N., Katoh, Y., Ishii, T., Iga-
rashi,K., Engel, J.D., etal. (1999) Keap1 represses nu-
clear activation of antioxidant responsive elements by Nrf2
through binding to the amino-terminal Neh2 domain,
Genes Dev., 13, 76-86, doi:10.1101/gad.13.1.76.
28. Katoh, Y., Iida, K., Kang, M.-I., Kobayashi, A., Mizuka-
mi, M., Tong, K.I., etal. (2005) Evolutionary conserved
N-terminal domain of Nrf2 is essential for the Keap1-me-
diated degradation of the protein by proteasome,
Arch. Biochem. Biophys., 433, 342-350, doi: 10.1016/
j.abb.2004.10.012.
29. Cho, H.-Y., Jedlicka, A. E., Reddy, S. P. M., Kensler,
T.W., Yamamoto, M., Zhang, L.-Y., etal. (2002) Role of
NRF2 in protection against hyperoxic lung injury in mice,
Am. J. Respir. Cell Mol. Biol., 26, 175-182, doi: 10.1165/
ajrcmb.26.2.4501.
30. Rangasamy, T., Cho, C. Y., Thimmulappa, R. K.,
Zhen,L., Srisuma, S.S., Kensler, T.W., etal. (2004) Ge-
netic ablation of Nrf2 enhances susceptibility to cigarette
smoke-induced emphysema in mice, J.Clin. Invest., 114,
1248-1259, doi:10.1172/jci200421146.
31. Aoki, Y., Sato, H., Nishimura, N., Takahashi, S., Itoh, K.,
and Yamamoto, M. (2001) Accelerated DNA adduct for-
mation in the lung of the Nrf2 knockout mouse exposed
to diesel exhaust, Toxicol. Appl. Pharmacol., 173, 154-160,
doi:10.1006/taap.2001.9176.
32. Rangasamy, T., Guo, J., Mitzner, W. A., Roman, J.,
Singh, A., Fryer, A.D., etal. (2005) Disruption of Nrf2
enhances susceptibility to severe airway inflammation and
asthma in mice, J.Exp. Med., 202, 47-59, doi:10.1084/
jem.20050538.
33. Thimmulappa, R. K., Lee, H., Rangasamy, T., Reddy,
S.P., Yamamoto, M., Kensler, T.W., etal. (2016) Nrf2
is a critical regulator of the innate immune response
and survival during experimental sepsis, J. Clin. Invest.,
116, 984-995, doi:10.1172/JCI25790.
34. Osburn, W. O., Wakabayashi, N., Misra, V., Nilles, T.,
Biswal, S., Trush, M.A., etal. (2006) Nrf2 regulates an
adaptive response protecting against oxidative damage
following diquat-mediated formation of superoxide an-
ion, Arch. Biochem. Biophys., 454, 7-15, doi: 10.1016/
j.abb.2006.08.005.
35. Higgins, L. G., Kelleher, M. O., Eggleston, I.M., Itoh,K.,
Yamamoto, M., and Hayes, J. D. (2009) Transcription
factor Nrf2 mediates an adaptive response to sulforaphane
that protects fibroblasts in vitro against the cytotoxic ef-
fects of electrophiles, peroxides and redox-cycling agents,
Toxicol. Appl. Pharmacol., 237, 267-280, doi: 10.1016/
j.taap.2009.03.005.
36. Moi, P., Chan, K., Asunis, I., Cao, A., and Kan, Y.W.
(1994) Isolation of NF-E2-related factor 2 (Nrf2), a NF-
E2-like basic leucine zipper transcriptional activator that
binds to the tandem NF-E2/AP1 repeat of the beta-globin
EGOROV et al.1996
BIOCHEMISTRY (Moscow) Vol. 88 Nos. 12-13 2023
locus control region, Proc. Natl. Acad. Sci. USA, 91, 9926-
9930, doi:10.1073/pnas.91.21.9926.
37. Kerins, M.J., and Ooi, A. (2018) The roles of NRF2 in
modulating cellular iron homeostasis, Antioxid. Redox Sig-
nal., 29, 1756-1773, doi:10.1089/ars.2017.7176.
38. Gebel, S., Diehl, S., Pype, J., Friedrichs, B., Weiler, H.,
Schüller, J., et al. (2010) The transcriptome of Nrf2
–/–
miceprovides evidence for impaired cell cycle progression
in the development of cigarette smoke-induced emphysem-
atous changes, Toxicol. Sci., 115, 238-252, doi:10.1093/
toxsci/kfq039.
39. Muramatsu, H., Katsuoka, F., Toide, K., Shimizu, Y., Fu-
rusako, S., and Yamamoto, M. (2013) Nrf2 deficiency leads
to behavioral, neurochemical and transcriptional changes
in mice, Genes Cells, 18, 899-908, doi:10.1111/gtc.12083.
40. Chartoumpekis, D. V., Ziros, P. G., Zaravinos, A., Iskren-
ova, R.P., Psyrogiannis, A.I., Kyriazopoulou, V.E., etal.
(2013) Hepatic gene expression profiling in Nrf2 knockout
mice after long-term high-fat diet-induced obesity, Oxid.
Med. Cell Longev., 2013, 340731, doi:10.1155/2013/340731.
41. Quiles, J. M., Narasimhan, M., Shanmugam, G., Mi-
lash,B., Hoidal, J.R., and Rajasekaran, N.S. (2017) Dif-
ferential regulation of miRNA and mRNA expression in
the myocardium of Nrf2 knockout mice, BMC Genomics,
18, 509, doi:10.1186/s12864-017-3875-3.
42. Ahmed, S. M. U., Luo, L., Namani, A., Wang, X.J., and
Tang, X. (2017) Nrf2 signaling pathway: pivotal roles in in-
flammation, Biochim. Biophys. Acta Mol. Basis Dis., 1863,
585-597, doi:10.1016/j.bbadis.2016.11.005.
43. Zinovkin, R. A., and Grebenchikov, O. A. (2020) Tran-
scription factor Nrf2 as a potential therapeutic target
for prevention of cytokine storm in COVID-19 pa-
tients, Biochemistry (Moscow), 85, 833-837, doi:10.1134/
S0006297920070111.
44. Chen, X.-L., Dodd, G., Thomas, S., Zhang, X., Was-
serman, M.A., Rovin, B.H., etal. (2006) Activation of
Nrf2/ARE pathway protects endothelial cells from oxi-
dant injury and inhibits inflammatory gene expression,
Am. J. Physiol. Heart Circ. Physiol., 290, H1862-H1870,
doi:10.1152/ajpheart.00651.2005.
Publisher’s Note. Pleiades Publishing remains neu-
tral with regard to jurisdictional claims in published
maps and institutional affiliations.