ISSN 0006-2979, Biochemistry (Moscow), 2025, Vol. 90, No. 8, pp. 1077-1087 © The Author(s) 2025. This article is an open access publication.
Published in Russian in Biokhimiya, 2025, Vol. 90, No. 8, pp. 1177-1188.
1077
Autoregulation of YB-1 Synthesis in Cells
Valeria S. Kachan
1
, Irina A. Eliseeva
2
, Andrey I. Buyan
2
, and Dmitry N. Lyabin
2,a
*
1
Laboratory of Experimental and Cellular Medicine, Moscow Institute of Physics and Technology,
141701 Dolgoprudny, Moscow Region, Russia
2
Group of Protein Biosynthesis Regulation, Institute of Protein Research, Russian Academy of Sciences,
142290 Pushchino, Moscow Region, Russia
a
e-mail: lyabin@vega.protres.ru
Received May 22, 2025
Revised July 4, 2025
Accepted July 18, 2025
Abstract— The Y-box binding protein 1 (YB-1) plays a crucial role in regulating essential cell functions, includ-
ing transcription, translation, and DNA repair, through its interactions with nucleic acids and multiple protein
partners. The multifunctionality of YB-1 makes the control of its levels critical for cellular homeostasis and
adaptation to stress. The synthesis of YB-1 is regulated by gene transcription, protein stability (mediated by
long non-coding RNAs), and translation of its mRNA. Autoregulation of YB-1 mRNA translation remains the
topic of ongoing debate. Some earlier in vitro studies suggested a role of the 5′ untranslated region (UTR)
in inhibiting protein synthesis, while others demonstrated the importance of YB-1 binding to the 3′ UTR for
reducing translation. This disagreement has been further complicated by the absence of evidence for these
mechanisms in living cells. Here, we provide the first direct evidence that YB-1 represses its synthesis in
cultured human cells. Using metabolic protein labeling and immunoprecipitation, we confirmed the effect
of YB-1 on the translation of its mRNA. Experiments with reporter constructs showed that both UTRs of the
YB-1 mRNA are involved in autoregulation, thus resolving the contradiction in the literature. These results
highlight a sophisticated mechanism for controlling YB-1 levels, which requires both 5′ and 3′ UTRs of the
YB-1 mRNA, and confirm their role in fine-tuning YB-1 synthesis.
DOI: 10.1134/S0006297925601571
Keywords: YB-1, translation regulation, mRNA
* To whom correspondence should be addressed.
INTRODUCTION
The Y-box binding protein 1 (YB-1) performs nu-
merous functions in the cell via interaction with nu-
cleic acids and binding to multiple partner proteins
[1, 2]. It is involved in the regulation of transcription
of a large set of genes and the control of both global
translation and specific regulation of translation of a
fairly large number of mRNAs. Additionally, it partic-
ipates in DNA repair, metabolism of small non-cod-
ing RNAs, alternative splicing, and some other cellu-
lar events (see reviews [1-3] and references therein).
This functional diversity ultimately determines the
important role of YB-1 in cell proliferation, differen-
tiation, apoptosis, etc. [1, 3, 4]. Notably, YB-1 plays a
specific role in oncogenesis, as cancer cells use its
diverse functions for their survival and adaptation to
challenging conditions [5, 6].
Strict control over the YB-1 amount in the cell is
essential for the normal cell life and survival under
stress. The regulation of the YB-1 gene transcription is
one of the options to control the YB-1 levels. It typical-
ly happens during cell differentiation, when one set
of transcription factors is replaced by another, thus
reducing the YB-1 mRNA synthesis [7]. Additionally,
the stability of YB-1 protein can be regulated by long
non-coding RNAs (for example, see [7]). However, for
precise adjustment of the YB-1 level, controlling the
translation of YB-1 mRNA is likely the most crucial
factor.
Though it has long been known that YB-1 regu-
lates the translation of its mRNA [8-10], the knowl-
edge of the regulatory mechanism remains sparse,
and the available data are somewhat contradictory.
KACHAN et al.1078
BIOCHEMISTRY (Moscow) Vol. 90 No. 8 2025
For example, according to Fukuda etal. [8], the 5′un-
translated region (UTR) of YB-1 mRNA is important
for autoregulation because preincubation of the YB-1
protein with luciferase reporter mRNA containing
the 5′  UTR of YB-1 mRNA leads to the inhibition of
luciferase synthesis in a cell-free translation system.
On the other hand, in a series of our studies [9-11],
we showed that YB-1 synthesis is inhibited by its spe-
cific binding to the 3′  UTR of YB-1 mRNA.
A controversial point in the work of Fukuda et
al. is that the site found within the 5′  UTR of YB-1
mRNA seems to be absent from natural YB-1 mRNAs
in most cell lines (for details, see [7]). Furthermore,
both these studies were conducted in cell-free transla-
tion systems, and the results have not been confirmed
ex vivo. The evidence for the autoregulation of YB-1
synthesis in cells could be provided by an experiment
with expressed exogenous tag-labeled YB-1 whose
presence should suppress the synthesis of endogenous
YB-1, thus reducing its amount. However, numerous
experiments of this type reported no decrease in the
amount of endogenous protein (see Fig.  4 in  [12];
Fig.  1 in  [13], and Fig.  1 in [14]), which might have
been due to the following reasons. Firstly, it is quite
difficult to ensure the long-term high expression of
YB-1 from a plasmid. As reported, the most frequently
achieved increase in the YB-1 amount is twofold, i.e.,
1  :  1 relative to the endogenous protein, which may
be insufficient to strongly inhibit the translation of
the YB-1 mRNA. Secondly, the high stability of YB-1
(according to our data, its half-life is ~60  h, see Fig.S1
in the Online Resource  1) may cause only a slight
change in the amount of endogenous protein during
the experiment (which is typically 48 h long), even
if synthesis is decreased. Thirdly, such experiments
show changes not in the level of YB-1 synthesis, but
only in the amount of protein, which, along with the
YB-1 mRNA translation, depends on the YB-1 mRNA
synthesis and stability of the protein itself.
In this work, we used metabolic labeling of cel-
lular proteins followed by immunoprecipitation with
anti-YB-1 antibodies to provide the first direct evi-
dence for the effect of YB-1 on its synthesis in cul-
tured human cells. Also, using reporter constructs,
we demonstrated that both 5′ and 3′  UTRs of the YB-1
mRNA are required for the autoregulation of YB-1
synthesis in cultured cells.
MATERIALS AND METHODS
Cell cultures. HEK293T∆YB-1 and HEK-
293T∆YB-1+YB-1 cells were described previously [15].
HeLa cells were kindly provided by Elena Nadezhdina
(Institute of Protein Research, Russian Academy of Sci-
ences). HEK293T cells were cultured in plastic dish-
es (Corning, USA) in Dulbecco Modified Eagle Me-
dium (DMEM) (Capricorn, Germany) supplemented
with 10% fetal calf serum (Hyclone, USA; Capricorn),
100  U/ml penicillin, and 100μg/ml streptomycin (Pan-
Eco, Russia; ServiceBio, China). HeLa cells were cul-
tured similarly, except that the medium was DMEM/
F12 (Capricorn). The cells were incubated in a CO
2
incubator at 37°C in a humidified atmosphere con-
taining 5%  CO
2
. As the cells grew, they were periodi-
cally reseeded after pre-treatment with trypsin-EDTA
(PanEco) to detach them from the plastic.
Transient transfection of cells was performed us-
ing Lipofectamine 3000 (Invitrogen, USA) according to
the manufacturer’s recommendations.
Analysis of YB-1 synthesis levels in cultured
cells using metabolic labeling. For [
35
S]-methionine
labeling, the cells were cultured in 35-mm dish-
es in L-methionine-free DMEM supplemented with
0.1  mCi/ml L-[
35
S]-methionine (Perkin Elmer, USA,
1000  Ci/mmol) for 1-2  h. The cells were then washed
with PBS and lysed with 400  μl of buffer containing
20  mM  Hepes-KOH, pH  7.6, 100  mM  KCl, 5  mM  MgCl
2
,
2  mM  DTT, 0.25%  Nonidet P-40, 0.2% SDS, and prote-
ase inhibitor cocktail (Roche, Switzerland). Cell ex-
tracts were cleared by centrifugation at 10,000g for
15 min and incubated with anti-YB-1 antibodies (rat
polyclonal antibodies against the 14-a.a. C-terminal
peptide of YB-1; IMTEK, Russia) and 20  μl of Protein
G-sepharose (GE Healthcare, USA) equilibrated with
the lysis buffer for 2  h at 4°C. After extensive washing
with PBS (6 times with 500  µl each), proteins were
eluted with the acid-urea sample solution (8  M urea,
5% acetic acid, 0.025% methylene blue) and analyzed
by acid-urea 10% polyacrylamide gel electrophoresis.
To detect radiolabeled proteins, the dried gel was
exposed to an intensifying screen followed by detec-
tion using a Cyclone®Storage PhosphorSystem (Pack-
ard Instrument Company Inc.). The relative amount
of radioactivity was determined using the OptiQuant
(ver. 03.00) software.
Immunoblotting. Proteins were transferred onto
a nitrocellulose membrane (Cytiva, USA) using an
electrophoretic transfer chamber and transfer buffer
(25  mM  Tris-HCl, pH  8.7, 90  mM  glycine, 10%  isopro-
panol, 0.1%  SDS). To prevent non-specific adsorption,
the membrane was incubated in TBS (10  mM  Tris-HCl,
pH  7.6, 150  mM NaCl) containing 5% dry fat-free milk
for 1h at room temperature. The membrane was then
incubated in TBS-T (10  mM  Tris-HCl, pH  7.6, 150  mM
NaCl, 0.05% Tween-20) containing 5% BSA and pri-
mary antibodies against YB-1 (Y0396; Sigma-Aldrich,
USA; dilution, 1  :  10000) or rps6 (2217S; Cell Signaling
Technology, USA; dilution, 1  :  10000) for 16-20h at 4°C.
The membrane was washed three times with TBS-T
and incubated in TBS-T containing 5% dry fat-fee milk
and secondary anti-rabbit IgG antibodies conjugated
AUTOREGULATION OF YB-1 SYNTHESIS IN CELLS 1079
BIOCHEMISTRY (Moscow) Vol. 90 No. 8 2025
Table 1. Sequences of primers used in the work
Primer Sequence (5′→3′)
F1 TGGTGGCGCGTCGCGCCG
R1 ATGGTCTTCACACTCGAAGATTTCGTTGG
F2 TGGCGGGACAGGCGGGATAAG
R2 ATGGTCTTCACACTCGAAGATTTCGTTGG
F3 CGGCGCGACGCGCCACCATTCTCGCTAGTTCGATCGGTAGCGG
R3 ATCTTCGAGTGTGAAGACCATGGTTGCGGTGATGGTGACTGGGG
F4 CTTATCCCGCCTGTCCCGCCACCCTTTAGCTGCCATCTTGCGTC
R4 ATCTTCGAGTGTGAAGACCATCGCCTTCCTCTCCTCCTCTGC
F5 GCTGTTCCGAGTAACCATCAAC
R5 GGTCCATACCGCTTTCTTGTG
F6 GGATTACCAGGGATTTCAGTCGATG
R6 GTTTTGTCACGATCAAAGGACTCTGGTAC
F7 ACACTCTTTCCCTACACGACGCTCTTCCGATCTAAGCAGTG GTATCAACGCAGAGT
R7 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGT CCATACCGCTTTCTTGTG
with horseradish peroxidase (A9169; Sigma-Aldrich;
dilution, 1  :  10000) for 1  h at room temperature. Next,
the membrane was washed 3 times in TBS-T for 5min
each. Proteins were detected using an Amersham ECL
Plus Western Blotting Detection System kit (Cytiva) ac-
cording to the manufacturer’s instructions.
Plasmid constructs. The pNL2.2 YB-1pr_YB-1_
NlucP_YB-1, pNL2.2 ACTBpr_BTF3_NlucP_BTF3, and
pNL2.2 ACTBpr_BTF3_Fluc_BTF3 plasmids were ob-
tained previously [15, 16]. The digestion of these
plasmids with the restriction endonucleases EcoRI and
BamHI produced the fragments containing 3′ UTRs of
the YB-1 and BTF3 (basic transcription factor 3) mRNAs
and vectors containing the YB-1 or ACTB (beta-actin)
promoter, the 5′  UTR of the YB-1 or BTF3 mRNAs, and
NlucP cDNA. Ligation of the obtained fragments into
the vectors yielded the pNL2.2 YB-1pr_YB-1_NlucP_
BTF3 and pNL2.2 ACTBpr_BTF3_NlucP_YB-1 plasmids.
The F1/R1 and F2/R2 primer pairs (Table 1) and
the above plasmids were used to generate the pNL2.2
YB-1pr_NlucP_BTF3, ACTBpr_NlucP_BTF3, pNL2.2
YB-1pr_NlucP_YB-1, and ACTBpr_NlucP_YB-1 vectors
that were assembled by SLIC (sequence and ligation
independent cloning) using the sequences containing
the 5′  UTRs of the YB-1 or BTF3 mRNAs. These se-
quences were obtained by PCR with the F3/R3 (YB-1
5′  UTR) and F4/R4 (BTF3 5′  UTR) primers (Table  1)
on the pNL2.2 YB-1pr_YB-1_NlucP_YB-1 and pNL2.2
ACTBpr_BTF3_NlucP_BTF3 plasmids, respectively.
The resultant plasmids were pNL2.2 YB-1pr_BTF3_
NlucP_BTF3, pNL2.2 YB-1pr_BTF3_NlucP_YB-1, pNL2.2
ACTBpr_YB-1_NlucP_YB-1, and pNL2.2 ACTBpr_YB-1_
NlucP_BTF3.
Measurement of luciferase activity in cells. The
next day after transfection with the plasmids encod-
ing luciferases (NlucP/Fluc ratio, 10  :  1), the cells were
reseeded into smaller dishes (to obtain 2 wells in 3
replicates for each cell line). After incubation for 24h,
half of the wells were used for the luciferase activi-
ty assay, and the rest – for the analysis of luciferase
mRNA levels by RT-qPCR.
The activities of NlucP (nanoluciferase with the
PEST sequence) and Fluc (firefly luciferase) were
measured using the Nano-Dual-Glo Luciferase Assay
System (Promega, USA). The cultured cells were lysed
in passive lysis buffer (PLB, Promega) for 10 min at
room temperature, and the enzymatic activity of lu-
ciferases was determined using a GloMax 20/20 lumi-
nometer (Promega).
The translation efficiency of the reporter mRNA
was calculated as the ratio between the NlucP lucif-
erase activity normalized to the activity of Fluc and
the relative amount of the NlucP mRNA normalized to
the amount of the control Fluc mRNA. When calculat-
ing the relative translation efficiency, the translation
efficiency in HEK293T∆YB-1 cells was taken as 100%.
KACHAN et al.1080
BIOCHEMISTRY (Moscow) Vol. 90 No. 8 2025
Reverse transcription-quantitative PCR (RT-qPCR).
Total RNA was isolated using a Direct-Zol RNA Micro-
prep kit (Zymo Research, USA) according to the manu-
facturer’s recommendations. One μg of total RNA was
reverse transcribed with Maxima H Minus reverse
transcriptase (Thermo Fisher Scientific, USA) accord-
ing to the manufacturer’s recommendations. qPCR
was performed in a QuantStudio 5 system (Thermo
Fisher Scientific) using the qPCRmix-HS SYBR+
LowROX reaction mixture (Evrogen, Russia). The
reaction mixture (25  μl) contained 0.5  μl of the re-
verse transcription reaction mixture and 0.2  μM of
each primer pair (F5/R5 for NlucP and F6/R6 for
Fluc; Table 1). The following amplification conditions
were used: 5  min at 95°C followed by 35 cycles of
95°C for 10  s, 57°C for 20  s, and 72°C for 10  s. In the
experiments measuring the relative mRNA amounts,
the content of the transcripts was calculated using the
QuantStudio™ Design & Analysis Software (Thermo
Fisher Scientific).
5′  RACE (rapid amplification of cDNA ends).
cDNAs for the 5′  RACE analysis were synthesized us-
ing a Mint RACE cDNA amplification kit (Evrogen)
according to the manufacturer’s recommendations
using the PlugOligo adapter and oligodT
18
. The first
round of PCR was performed with the NlucP and
PlugOligo-specific primers F7 and R7 (Table 1) carry-
ing additional Illumina adapter sequences. PCR prod-
ucts were purified with SPRIselect beads (NEB, USA)
according to the manufacturer’s recommendations.
The second round of PCR was performed using the
primers from the NEBNext Dual Index Primers Set 1
for Illumina (NEB, USA). PCR products were purified
with SPRIselect beads and sequenced on the Nova-
Seq6000 platform (Illumina) at the Skoltech Research
Facilities Center (Genomics Facilities), Skolkovo Insti-
tute of Science and Technology, Russia. The resulting
reads were processed with cutadapt v. 4.8 [17] to re-
move adapter sequences and 5′  poly-G tracks added
by Mint reverse transcriptase. The mapping of the
reads to pNL2.2 sequences was performed with bwa
mem v.0.7.17 [18]. The cumulative 5′  end coverage of
the reads was calculated with bedtools v. 2.30.0 [19].
Statistical analysis of the experimental data
was carried out using the one- or two-tailed Student’s
t-tests for independent samples in the R software en-
vironment.
RESULTS AND DISCUSSION
Autoregulation of YB-1 synthesis in HeLa cells.
To understand how YB-1 controls its synthesis at the
translation level, we designed an experiment aimed
at elucidating whether increasing the amount of YB-1
in a cell by introducing additional YB-1 synthesized
from a plasmid would reduce the endogenous expres-
sion of YB-1 (Fig.1). Note that we used HeLa cells be-
cause a significant portion of the YB-1 mRNA in these
cells is polysome-associated [20], providing conditions
in which a clear decrease in the protein synthesis
level can be expected in the case of autoregulation.
HeLa cells were transfected with the pcDNA3- HA-YB-1
plasmid encoding hemagglutinin-tagged YB-1 (HA-YB-1)
to distinguish between the exogenous and endogenous
YB-1 and cultured in the presence of [
35
S]-methionine
after 24 or 48 h.
Importantly, the pcDNA3-HA-YB-1 plasmid did not
encode the UTRs of the YB-1 mRNA; therefore, the
translation of the plasmid-synthesized HA-YB-1 mRNA
should not have been regulated by either endogenous
YB-1 or exogenous HA-YB-1. The expression of the
exogenous HA-YB-1 reached its maximum 24 h after
the transfection (Fig.  1a). The amounts of HA-YB-1
and YB-1 were approximately equal, with no notable
changes in the amount of the latter. However, the syn-
thesis of endogenous YB-1 24  h after the transfection
(Fig.  1, b and c) decreased in the HA-YB-1-express-
ing cells, while the level of total protein synthesis in
these cells remained unchanged. Interestingly, 48  h af-
ter transfection, the synthesis of exogenous HA-YB-1
dropped down to the level of YB-1 synthesis, which
returned to the values observed in the cells that did
not express HA-YB-1. This means that 48h after trans-
fection, the amount of exogenous HA-YB-1 decreased
(Fig.  1a) and was no longer sufficient to inhibit the
synthesis of endogenous YB-1. This decrease might
have been caused by the inability of HeLa cells to
efficiently replicate the pcDNA3 plasmid. Accordingly,
an approximately twofold decrease in the amount of
exogenous HA-YB-1 could be expected after roughly
one cell division cycle, as shown in Fig. 1a.
The effect of YB-1 on the translation of re-
porter mRNAs containing the 5′ and 3′  UTRs of the
YB-1 mRNA in HEK293T cells. A drawback of the
above-described experiment is the inability to reveal
the role of the YB-1 mRNA UTRs in the regulation of
translation of this mRNA by YB-1. This problem can
be solved by using plasmid constructs encoding a re-
porter gene (NlucP in our case) flanked by the UTRs
of the YB-1 mRNA or some control mRNA (here, BTF3
mRNA) (Fig.  2a). It is important to use the plasmids,
because in the case of cell transfection with mRNAs,
a significant fraction of these mRNAs remains inactive
within the liposomal particles [21]. Also, we used a
modified nanoluciferase that contained an instabili-
ty element (PEST domain) that reduced its half-life
to 15 min [16]. This allows measuring the amount of
protein synthesized within a certain time interval,
which, together with the known amount of NlucP
mRNA, indicates the level of mRNA from which this
protein was synthesized. Therefore, we were able
AUTOREGULATION OF YB-1 SYNTHESIS IN CELLS 1081
BIOCHEMISTRY (Moscow) Vol. 90 No. 8 2025
Fig. 1. The autoregulation of YB-1 synthesis in HeLa cells. a) The content of YB-1 (endogenous) and HA-YB-1 (exogenous)
proteins in HeLa cells transfected with pcDNA3-HA-YB-1 or pcDNA3-HA 24 and 48 h after transfection was analyzed by
immunoblotting with anti-YB-1 antibodies (1). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a loading
control. Band intensities for endogenous (YB-1) and exogenous (HA-YB-1) proteins (2). b) The levels of synthesis of en-
dogenous (YB-1) and exogenous (HA-YB-1) proteins were determined by metabolic protein labeling with [
35
S]-methionine
followed by YB-1 immunoprecipitation(1). All samples contained the same amount of total protein (2). c) Relative levels of
YB-1 protein synthesis as determined from the radioactivity of the YB-1-corresponding bands in the autoradiograph shown
in panel b (2). The level of YB-1 synthesis in the cells transfected with pcDNA3-HA was taken as 100%. The values are
shown as means ±2 standard deviations(SD) from three independent experiments. The two-tailed Student’s t-test was used
to assess the statistical significance of differences; **  p  <  0.01; ***  p  <  0.005; #  statistically insignificant.
to determine the translation efficiency of the report-
er mRNA. The results were normalized against the
translation of the control RNA. Note that the YB-1 and
ACTB promoters were used as the reporter gene pro-
moters in the pNL2.2 plasmids (Fig.  2a).
To demonstrate the effect of YB-1 on the trans-
lation of reporter mRNAs, two types of cells should
be used – with low or no YB-1 and with the normal
YB-1 level. Accordingly, we used HEK293TΔYB-1 cells
in which the synthesis of endogenous YB-1 was
blocked using the CRISPR/Cas9 genome editing system,
and HEK293TΔYB-1+YB-1 cells stably expressing YB-1
at a level comparable to that of endogenous protein
in normal HEK293T cells (Fig. 2b). These cells were
transfected with pNL2.2 plasmids encoding the NlucP
mRNAs with the 5′ and 3′  UTRs from the YB-1 and/
or BTF3 mRNAs under control of the YB-1 or ACTB
promoters. As an internal control, we introduced
KACHAN et al.1082
BIOCHEMISTRY (Moscow) Vol. 90 No. 8 2025
Fig. 2. Genetic constructs and cell lines used in the study. a)pNL2.2 plasmids encoding the reporter NlucP mRNAs containing
a combination of UTRs from the YB-3 and BTF3 mRNAs and pNL2.2BTF3_Fluc_BTF3 plasmid encoding the Fluc mRNA (inter-
nal control) that were used for the transfection of HEK293TΔYB-1 and HEK293TΔYB-1+YB-1 cells. b)Analysis of YB-1 content
in HEK293T, HEK293TΔYB-1, and HEK293TΔYB-1+YB-1 cells. Rps6 (ribosomal protein S6) was used as a loading control.
Fig. 3. Translation of the NlucP mRNA containing the 5′ and 3′ UTRs from the YB-1 and/or BTF3 mRNA under control of
the YB-1 (a) or ACTB (b) promoters in HEK293TΔYB-1 and HEK293TΔYB-1+YB-1 cells. Twenty-four hours after transfection
with the pNL2.2 plasmids (Fig. 2a), the cells were harvested and divided into two fractions. Total RNA isolated from one
fraction were used for measuring the amounts of NlucP and Fluc mRNAs by RT-qPCR. Cells from the other fraction were
used for determining the activities of NlucP and Fluc. The relative level of NlucP translation was calculated as the NlucP
activity normalized to the amount of mRNA. The level of translation in HEK293TΔYB-1 cells is taken as 100%. c) Same
as(a) and(b), except that the graph shows the absolute values of the translation level. The values shown are as means ±SD
from three independent experiments. The one-tailed Student’s t-test was used to assess statistical significance; *  p  <  0.05,
**  p  <  0.01, ***  p  <  0.001; #  statistically insignificant.
AUTOREGULATION OF YB-1 SYNTHESIS IN CELLS 1083
BIOCHEMISTRY (Moscow) Vol. 90 No. 8 2025
Fig.  4. Analysis of the transcription start sites from the pNL2.2 plasmids in HEK293TΔYB-1 and HEK293TΔYB-1+YB-1
cells. The cells were transfected with the pNL2.2-YB-1_YB-1-NlucP-YB-1, pNL2.2-YB-1_BTF3-NlucP-BTF3, pNL2.2-ACTB_YB-1-
NlucP-YB-1, and pNL2.2-ACTB_BTF3-NlucP-BTF3 plasmids. After 24h, total RNA was isolated from the cells, and the 5′ ends
of the reporter mRNAs were analyzed by 5′ RACE.
a plasmid encoding the Fluc mRNA with the 5′ and
3′  UTRs from the BTF3 mRNA along with the pNL2.2
plasmid.
After 24 h of culturing, RNA was isolated from a
fraction of cells to measure the amount of synthesized
NlucP and Fluc mRNAs, while the remaining cells
were used to measure the activity of NlucP and Fluc
luciferases. The activity of the former was normalized
to the Fluc activity (internal control); the amount of
the NlucP mRNA was normalized to the amount of
the Fluc mRNA.
Figure 3a shows that upon the restoration of the
YB-1 amount in the cells, the decrease in the trans-
lation efficiency of the NlucP mRNA containing both
UTRs of the YB-1 mRNA was much stronger (~3-fold)
than that of the reporter mRNA with the UTRs from
the control BTF3 mRNA (~1.3-fold). The presence of
either of the reporter mRNAs containing solely the
5′ or 3′  UTR of the YB-1 mRNA was insufficient for
the suppression of mRNA translation by YB-1 to the
same extent as when both UTRs from the YB-1 mRNA
were used. Although the translation of the reporter
mRNA with the YB-1 mRNA 5′  UTR was more sensitive
to YB-1, both UTRs of the YB-1 mRNA were required
for the efficient regulation of the YB-1 mRNA trans-
lation by YB-1 (Fig. 3a).
Interestingly, the use of plasmid constructs with
the reporter genes under control of the ACTB pro-
moter produced the same results (Fig. 3b). The great-
est sensitivity of translation to the presence of YB-1
was observed for the reporter mRNA with both UTRs
of the YB-1 mRNA, although the effect was less pro-
nounced.
This observation may have different explanations.
The start of the mRNA sequence containing the YB-1
mRNA 5′  UTR and the YB-1 promoter corresponds to
the start of the main transcription site for HEK293T
cells, according to the FANTOM project [22] and the
dbTSS database [23]: the length of the YB-1 mRNA
5′ UTR is 140 nucleotides. The use of the ACTB pro-
moter increases the 5′  UTR sequence by 9 nucleotides
at the 5′  end (Fig.4, Fig.S2 in the Online Resource1).
KACHAN et al.1084
BIOCHEMISTRY (Moscow) Vol. 90 No. 8 2025
Fig. 5. The content of NlucP mRNA containing 5′ and 3′ UTRs from the YB-1 and/or BTF3 mRNAs synthesized from the YB-1
or ACTB promoters in HEK293TΔYB-1 and HEK293TΔYB-1+YB-1 cells. The amounts of mRNAs are taken from Fig.3. The level
of NlucP mRNA in HEK293TΔYB-1 cells was considered as 1. The results shown are the means ±SD of three independent
experiments. The one-tailed Student’s t-test was used to assess statistical significance; ***  p  <  0.001.
Similarly, the length of the BTF3 mRNA 5′  UTR upon
the use of the ACTB promoter increases from 221 to
228 nucleotides. This slight extension may affect the
regulation of its translation by the YB-1 protein. An
alternative and more probable explanation is that
mRNAs synthesized from different promoters might
be modified differently or recruit different sets of
RNA-binding proteins, which ultimately affects the ef-
ficiency of its translation and regulation. For example,
as reported recently, a promoter can affect not only
the efficiency of transcription, but also the efficiency
of translation [24].
The latter explanation is indirectly supported
by the fact that the translation level (translation
per RNA in absolute values) of mRNAs synthesized
from the ACTB promoter was significantly higher
than that of mRNAs synthesized from the YB-1 pro-
moter (Fig. 3c).
Another important fact about the effect of YB-1
on the synthesis or amount of its mRNA is that during
the YB-1 synthesis, the amount of reporter mRNA de-
creased, which may indicate a negative effect of YB-1
on transcription not only from the YB-1 promoter, but
also from the ACTB promoter (Fig. 5). The effect of
YB-1 on transcription has long been reported [1], but
this might have been a non-specific effect on the over-
all transcription, probably, due to the YB-1 involve-
ment in the regulation of many genes participating in
transcription. Nevertheless, it cannot be ruled out that
both the YB-1 and ACTB promoters can be YB-1-regu-
lated in certain situations, which requires additional
studies.
CONCLUSION
Taken together, the above facts provide evidence
for the existence of the autoregulation of YB-1 syn-
thesis in cultured mammalian cells. We can also state
that both 5′ and 3′  UTRs of the YB-1 mRNA mediate
the inhibitory effect of YB-1 on its translation. Previ-
ously, in vitro experiments showed that removal of
the regulatory element from the YB-1 mRNA 3′  UTR
is sufficient to eliminate the inhibitory effect of YB-1
[11]. Still, the situation may be more complicated
in cultured eukaryotic cells, where the YB-1 mRNA
5′  UTR has been shown to participate in the autoreg-
ulation of YB-1 synthesis [8].
Presumably, the spatial proximity of the 5′ and
3′  UTRs of the YB-1 mRNA can allow YB-1, through its
specific interaction with the regulatory element in the
3′  UTR, to influence the initiation of the YB-1 mRNA
translation. Presumably, such proximity can be pro-
vided by proteins interacting with both UTRs of this
mRNA. Also, it cannot be ruled out that YB-1 itself
interacts simultaneously with the 5′ and 3′  UTRs of
the YB-1 mRNA. Besides, in many mRNAs, the 5′ and
3′  ends are close to each other due to the secondary
structure architecture [25]. This suggests that the
5′  UTR of the YB-1 mRNA might be in proximity to
the 3′  UTR, thereby contributing to the effect of the
3′  UTR-bound YB-1 on translation. In any case, the
5′  UTR of the YB-1 mRNA is likely an element pro-
viding an increased sensitivity of the YB-1 mRNA
translation to YB-1, while the 3′  UTR serves as a YB-1
carrier.
AUTOREGULATION OF YB-1 SYNTHESIS IN CELLS 1085
BIOCHEMISTRY (Moscow) Vol. 90 No. 8 2025
The discussion on the inhibitory effect of YB-1 on
its synthesis cannot ignore a surprising fact recent-
ly reported by Wang et al. [26] who found that the
5′  UTR of the YB-1 mRNA participates in the regulation
of its translation. Overexpression of Flag-YB-1 from a
plasmid in glioblastoma cells stimulated the synthe-
sis of both endogenous YB-1 and a reporter mRNA
containing the YB-1 mRNA 5′  UTR. This suggests that
the effect of YB-1 on the translation of its mRNA can
vary depending on the cellular context and, probably,
other proteins interacting with the YB-1 mRNA UTRs.
However, it cannot be ruled out that the properties of
Flag-YB-1 used by Wang et al. were altered due to a
high negative charge of the Flag tag (more precisely,
3xFlag tag) that could interact with or block positively
charged amino acid residues of the YB-1 C-terminal
domain.
Some other proteins interacting with the YB-1
mRNA UTRs may also be involved in the regulation
of translation of the YB-1 mRNA in the cells. For ex-
ample, involvement of the poly(A)-binding protein
(PABP) and heterogeneous nuclear ribonucleoprotein
Q (hnRNP Q) in this process has been shown invitro
[11, 27]. Therefore, the mechanism of regulation of
the YB-1 mRNA translation by YB-1 requires further
investigation.
Abbreviations
ACTB beta-actin;
BTF3 basic transcription factor3;
Fluc firefly luciferase;
NlucP
nanoluciferase with the PEST se-
quence;
UTR untranslated region;
YB-1 Y-box binding protein1.
Supplementary information
The online version contains supplementary material
available at https://doi.org/10.1134/S0006297925601571.
Acknowledgments
We thank the staff of the Skoltech Research Facilities
Center (Genomics Facilities), Skolkovo Institute of Sci-
ence and Technology, Russia, for help with the library
quality assessment, basic analysis of bioinformatics
data, and sequencing on the NovaSeq6000 platform.
We thank E. Serebrova for help in manuscript prepa-
ration.
Contributions
D.N.L. developed the study concept and supervised the
study; D.N.L., I.A.E., V.S.K., and A.I.B. conducted the ex-
periments; D.N.L. and I.A.E. validated the data; D.N.L.
wrote the text of the article; I.A.E. edited the manu-
script.
Funding
This work was performed under the State Assign-
ment of the Ministry of Science and Higher Education
of the Russian Federation (Structural and Functional
Studies of Proteins and Macromolecular Complexes,
no. 125011500317-6; experiments on the YB-1 mRNA
translation in cells) and supported by the Russian
Science Foundation (project no. 19-74-20129; 5′ RACE
analysis of reporter mRNAs).
Ethics approval and consent to participate
This work does not contain any studies involving hu-
man or animal subjects.
Conflict of interest
The authors of this work declare that they have
noconflicts of interest.
Open access
This article is licensed under a Creative Commons At-
tribution4.0 International License, which permits use,
sharing, adaptation, distribution, and reproduction
in any medium or format, as long as you give appro-
priate credit to the original author(s) and the source,
provide a link to the Creative Commons license, and
indicate if changes were made. The images or other
third party material in this article are included in the
article’s Creative Commons license, unless indicated
otherwise in a credit line to the material. If material is
not included in the article’s Creative Commons license
and your intended use is not permitted by statutory
regulation or exceeds the permitted use, you will need
to obtain permission directly from the copyright hold-
er. To view a copy of this license, visit http://creative-
commons.org/licenses/by/4.0/.
REFERENCES
1. Eliseeva, I.A., Kim, E.R., Guryanov, S.G., Ovchinnikov,
L.P., and Lyabin, D.N. (2011) Y-box-binding protein1
(YB-1) and its functions, Biochemistry (Moscow), 76,
1402-1433, https://doi.org/10.1134/S0006297911130049.
2. Mordovkina,D., Lyabin, D.N., Smolin, E.A., Sogorina,
E.M., Ovchinnikov, L.P., and Eliseeva,I. (2020) Y-Box
binding proteins in mRNP assembly, translation,
and stability control, Biomolecules, 10, 591, https://
doi.org/10.3390/biom10040591.
3. Lyabin, D. N., Eliseeva, I. A., and Ovchinnikov, L. P.
(2014) YB-1 protein: functions and regulation, Wiley
Interdiscip. Rev. RNA, 5, 95-110, https://doi.org/10.1002/
wrna.1200.
4. Lindquist, J. A., and Mertens, P. R. (2018) Cold shock
proteins: from cellular mechanisms to pathophysiol-
ogy and disease, Cell Commun. Signal., 16, 63, https://
doi.org/10.1186/s12964-018-0274-6.
KACHAN et al.1086
BIOCHEMISTRY (Moscow) Vol. 90 No. 8 2025
5. Alkrekshi,A., Wang,W., Rana, P.S., Markovic,V., and
Sossey-Alaoui, K. (2021) A comprehensive review of
the functions of YB-1 in cancer stemness, metastasis
and drug resistance, Cell Signal., 85, 110073, https://
doi.org/10.1016/j.cellsig.2021.110073.
6. Johnson, T.G., Schelch,K., Mehta,S., Burgess,A., and
Reid, G. (2019) Why be one protein when you can
affect many? Themultiple roles of YB-1 in lung can-
cer and mesothelioma, Front. Cell. Dev. Biol., 7, 221,
https://doi.org/10.3389/fcell.2019.00221.
7. Eliseeva, I.A., Sogorina, E.M., Smolin, E.A., Kulakovs-
kiy, I. V., and Lyabin, D. N. (2022) Diverse regulation
of YB-1 and YB-3 abundance in mammals, Biochem-
istry (Moscow), 87, S48-S167, https://doi.org/10.1134/
S000629792214005X.
8. Fukuda,T., Ashizuka,M., Nakamura,T., Shibahara,K.,
Maeda, K., Izumi, H., Kohno, K., Kuwano, M., and
Uchiumi,T. (2004) Characterization of the 5′-untrans-
lated region of YB-1 mRNA and autoregulation of
translation by YB-1 protein, Nucleic Acids Res., 32,
611-622, https://doi.org/10.1093/nar/gkh223.
9. Skabkina, O. V., Lyabin, D. N., Skabkin, M. A., and
Ovchinnikov, L. P. (2005) YB-1 autoregulates trans-
lation of its own mRNA at or prior to the step of
40S ribosomal subunit joining, Mol. Cell. Biol., 25,
3317-3323, https://doi.org/10.1128/MCB.25.8.3317-
3323.2005.
10. Skabkina, O. V., Skabkin, M. A., Lyabin, D. N., and
Ovchinnikov, L. P. (2004) P50/YB-1, a major pro-
tein of cytoplasmic mRNPs, regulates its own syn-
thesis, Dokl. Biochem. Biophys., 395, 93-95, https://
doi.org/10.1023/b:dobi.0000025554.28703.bf.
11. Lyabin, D. N., Eliseeva, I. A., Skabkina, O. V., and
Ovchinnikov, L.P. (2011) Interplay between Y-box-bind-
ing protein 1 (YB-1) and poly(A) binding protein
(PABP) in specific regulation of YB-1 mRNA trans-
lation, RNA Biol., 8, 883-892, https://doi.org/10.4161/
rna.8.5.16022.
12. Ha,B., Lee, E.B., Cui,J., Kim,Y., and Jang, H.H. (2015)
YB-1 overexpression promotes a TGF-beta1-induced
epithelial-mesenchymal transition via Akt activation,
Biochem. Biophys. Res. Commun., 458, 347-351, https://
doi.org/10.1016/j.bbrc.2015.01.114.
13. Kim, E. R., Selyutina, A. A., Buldakov, I. A.,
Evdokimova,V., Ovchinnikov, L.P., and Sorokin, A.V.
(2013) The proteolytic YB-1 fragment interacts with
DNA repair machinery and enhances survival during
DNA damaging stress, Cell Cycle, 12, 3791-3803,
https://doi.org/10.4161/cc.26670.
14. Lyabin, D. N., Eliseeva, I. A., Smolin, E. A., Doronin,
A. N., Budkina, K. S., Kulakovskiy, I. V., and Ovchin-
nikov, L. P. (2020) YB-3 substitutes YB-1 in glob-
al mRNA binding, RNA Biol., 17, 487-499, https://
doi.org/10.1080/15476286.2019.1710050.
15. Lyabin, D. N., Smolin, E. A., Budkina, K. S., Eliseeva,
I.A., and Ovchinnikov, L.P. (2021) Towards the mech-
anism(s) of YB-3 synthesis regulation by YB-1, RNA
Biol., 18, 1630-1641, https://doi.org/10.1080/15476286.
2020.1859243.
16. Eliseeva,I., Vasilieva,M., and Ovchinnikov, L.P. (2019)
Translation of human beta-actin mRNA is regulat-
ed by mTOR pathway, Genes (Basel), 10, 96, https://
doi.org/10.3390/genes10020096.
17. Martin,M. (2011) Cutadapt removes adapter sequenc-
es from high-throughput sequencing reads, EMBnetJ.,
17, 10-12, https://doi.org/10.14806/ej.17.1.200.
18. Li,H. (2013) Aligning sequence reads, clone sequences
and assembly contigs with BWA-MEM, arXiv, https://
doi.org/10.48550/arXiv.1303.3997.
19. Quinlan, A. R. (2014) BEDTools: the Swiss-army tool
for genome feature analysis, Curr. Protoc. Bioinfor-
matics, 47, 11.12.11-11.12.34, https://doi.org/10.1002/
0471250953.bi1112s47.
20. Lyabin, D. N., Eliseeva, I. A., and Ovchinnikov, L. P.
(2012) YB-1 synthesis is regulated by mTOR signaling
pathway, PLoS One, 7, e52527, https://doi.org/10.1371/
journal.pone.0052527.
21. Barreau, C., Dutertre, S., Paillard, L., and Osborne,
H. B. (2006) Liposome-mediated RNA transfection
should be used with caution, RNA, 12, 1790-1793,
https://doi.org/10.1261/rna.191706.
22. FANTOM Consortium and the RIKEN PMI and CLST
(DGT) (2014) Apromoter-level mammalian expression
atlas, Nature, 507, 462-470, https://doi.org/10.1038/
nature13182.
23. Suzuki, A., Kawano, S., Mitsuyama, T., Suyama, M.,
Kanai, Y., Shirahige, K., Sasaki, H., Tokunaga, K.,
Tsuchihara, K., Sugano, S., Nakai, K., and Suzuki, Y.
(2018) DBTSS/DBKERO for integrated analysis of
transcriptional regulation, Nucleic Acids Res., 46,
D229-D238, https://doi.org/10.1093/nar/gkx1001.
24. Peterman, E.L., Ploessl, D.S., Love, K.S., Sanabria,V.,
Daniels, R.F., Johnstone, C.P., Godavarti, D.R., Kabaria,
S.R., Oakes, C.G., Pai, A.A., and Galloway, K.E. (2025)
High-resolution profiling reveals coupled transcrip-
tional and translational regulation of transgenes, Nu-
cleic Acids Res., 53, gkaf528, https://doi.org/10.1093/
nar/gkaf528.
25. Lai, W.C., Kayedkhordeh,M., Cornell, E.V., Farah,E.,
Bellaousov,S., Rietmeijer,R., Salsi,E., Mathews, D.H.,
and Ermolenko, D. N. (2018) mRNAs and lncRNAs
intrinsically form secondary structures with short
end-to-end distances, Nat. Commun., 9, 4328, https://
doi.org/10.1038/s41467-018-06792-z.
26. Wang, J.Z., Zhu,H., You,P., Liu,H., Wang, W.K., Fan,X.,
Yang,Y., Xu,K., Zhu,Y., Li,Q., Wu,P., Peng,C., Wong,
C.C., Li,K., Shi,Y., Zhang,N., et al. (2022) Upregulated
YB-1 protein promotes glioblastoma growth through
a YB-1/CCT4/mLST8/mTOR pathway, J.Clin. Invest.,
https://doi.org/10.1172/JCI146536.
27. Lyabin, D. N., Nigmatullina, L. F., Doronin, A. N.,
Eliseeva, I. A., and Ovchinnikov, L. P. (2013) Identi-
AUTOREGULATION OF YB-1 SYNTHESIS IN CELLS 1087
BIOCHEMISTRY (Moscow) Vol. 90 No. 8 2025
fication of proteins specifically interacting with YB-1
mRNA 3′ UTR and the effect of hnRNP Q on YB-1
mRNA translation, Biochemistry (Moscow), 78, 651-
659, https://doi.org/10.1134/S0006297913060102.
Publisher’s Note. Pleiades Publishing remains
neutral with regard to jurisdictional claims in published
maps and institutional affiliations. AI tools may have
been used in the translation or editing of this article.